(M1430-09-52) Regulated qPCR Validation and qPCR/ddPCR Cross-Validation

Purpose: Many promising therapeutic agents have been produced because of the rapidly growing fields of cell and gene therapy. Although qPCR and ddPCR assays produce fast, reliable, and robust pharmacokinetic and pharmacodynamic profiles of these therapeutic agents, regulatory bodies have yet to create guidelines for the development and validation of qPCR and ddPCR methods, presenting a costly hurdle in the process of approving novel and life-saving treatments for clinical use. To address this, we adapted current regulatory guidelines for bioanalytical method validations (LBA) and referred to peer publications to develop a “Fit for purpose” GLP-compliant protocol for the development and validation of qPCR and ddPCR methods. In addition, to compare the efficacy of the two methods, we used shared matrix calibrators to cross-validate the results from the two methods.

Methods: pAAV2-hrGFP plasmid was prepared and purified using a Qiagen MaxiPrep kit. The highly purified plasmid was linearized by Not I digestion and then measured by Invitrogen Qubit 4 Fluorometer to measure weight DNA concentration (ng/µL). The known molecular weight of the plasmid was then used to convert weight DNA concentration to copy number concentration (https://www.endmemo.com/bio/dnacopynum.php). Human blood genomic DNA was prepared using the Qiagen QIAmp DNA Blood MaxiPrep kit, which was further digested by Not I and adjusted its concentration to 25 ng/uL (human gDNA solution). Linearized pAAV2-hrGFP plasmid DNA was serially diluted (4-fold) by HgDNA solution to generate the following standards: 2.5x10⁷, 6.25x10⁶, 1.56x10⁶, 3.90x10⁵, 9.76x10⁴, 2.44x10⁴, 6.10x10³, 1.53x10², 381.5, 95.4, 23.8, 6.0, and 1.5 copies/µL (Figure 1).

qPCR and ddPCR were run using these standards. Recovery experiments were run by spiking linearized plasmid DNA into pooled human blood and urine. DNA extraction was performed using the KingFisher Flex automated nucleic acid extraction system, DNA purity was determined using a NanoDrop UV spectrometer, and DNA weight concentration was determined using Invitrogen Qubit 4 Fluorometer. The PCR primers used were CMV-F (5’ TTCCTACTTGGCAGTACATCTACG 3’) and CMV-R (5’ GTCAATGGGGTGGAGACTTGG 3’). The probe used was CMV-P (6FAM-TGAGTCAAACCGCTATCCACGCCC A-MGBNFQ). For both qPCR and ddPCR, 10 µL of DNA template (250 ng of hgDNA) was used in a 20 µL reaction mix. For qPCR, the QuantStudio 7Flex instrument then generated raw Ct data. By creating an Excel Macro that performed a log transformation of the DNA copy numbers, we could generate a linear regression model for qPCR and then incorporate the qPCR data analysis into the Watson LIMS system.

Results: As detailed in Table 1A, we adapted the FDA Bioanalytical Method Validation Guideline to a qPCR PK method development and validation. Plasmid DNA spiked into human blood and urine generated recovery rates after extraction of about 51% and 81%, respectively. We set up qPCR QC levels (Table 1b) that were successful in all assays. We produced a linear regression (Figure 1A, 1B, 2A) within acceptable parameters using the 12 standards (Amplification Efficiency = 103.5%, r² = 0.996). Running the 7 standards with the lowest concentrations through our ddPCR protocol also produces a linear regression (Figure 1C, 2B) within acceptable parameters (r² = 0.9995); the other 5 standards could not be used, as they are above quantitation limit for BioRad QX200 ddPCR system. Plotting the copy number concentrations produced by the ddPCR against the Ct numbers generated by qPCR (Figure 2C) also produces a nearly perfect linear relationship, demonstrating that ddPCR and qPCR data are strongly correlated.

Conclusion: We have demonstrated that the absolute quantitation of clinical samples can be derived precisely using ddPCR or rapidly using qPCR, a substantial boon for the fields of Cell and Gene Therapy. To this end, we have developed a panel of protocols that facilitate the efficient extraction of gDNA from about 24 different matrices. These protocols allow high-throughput DNA extraction by KingFisher automatic nucleic acid extraction system from a 96 deep well plate that result in high yields and purity. Furthermore, we have established a “Fit for Purpose” qPCR validation method which can be performed by adapting to regulatory documents on bioanalytical method validations. Such a qPCR validation method can be cross-validated by ddPCR on shared calibrators. Our validated qPCR method can directly determine a larger range of amplicon concentrations (from 1x10¹ to 1x10⁷ copies/µL) with minimal sample DNA dilution. In contrast, ddPCR measures the fraction of positive droplets and then derives a Poisson-distribution adjusted count, and thus can only perform absolute copy quantitation for 0 up to 1x10⁵ amplicons per sample (10 µL DNA template in a 20 µL reaction). Consequently, ddPCR utilizes diluted DNA samples if the concentration is over 1x10⁴ copies/µL, meaning it can effectively analyze small volumes of input. To summarize, our work provides a standardized and regulatory-friendly framework for qPCR, and further cements both qPCR and ddPCR as robust and reliable techniques to quantify a gene of interests in both academic and industrial settings.

References: 1. Guidance for Industry: Bioanalytical Method Validation. (2018).
2. EMA. Bioanalytical method validation. European Medicines Agency https://www.ema.europa.eu/en/bioanalytical-method-validation (2018).
3. Hays, A., Islam, R., Matys, K. & Williams, D. Best Practices in qPCR and dPCR Validation in Regulated Bioanalytical Laboratories. AAPS J. 24, 36 (2022).
4. Ma, H., Bell, K. N. & Loker, R. N. qPCR and qRT-PCR analysis: Regulatory points to consider when conducting biodistribution and vector shedding studies. Mol. Ther. Methods Clin. Dev. 20, 152–168 (2020).
5. Immunogenicity Testing of Therapeutic Protein Products —Developing and Validating Assays for Anti-Drug Antibody Detection Guidance for Industry. 37 (2019).
6. Ross, G. M. S., Filippini, D., Nielen, M. W. F. & Salentijn, G. IJ. Unraveling the Hook Effect: A Comprehensive Study of High Antigen Concentration Effects in Sandwich Lateral Flow Immunoassays. Anal. Chem. 92, 15587–15595 (2020).
7. Gupta, N. DNA Extraction and Polymerase Chain Reaction. J. Cytol. 36, 116–117 (2019).
8. Lou, J. J. et al. A review of room temperature storage of biospecimen tissue and nucleic acids for anatomic pathology laboratories and biorepositories. Clin. Biochem. 47, 267–273 (2014).
9. Sugimoto, H. et al. Insights on Droplet Digital PCR–Based Cellular Kinetics and Biodistribution Assay Support for CAR-T Cell Therapy. AAPS J. 23, 36 (2021).
10. Clarner, P. et al. Development of a one-step RT-ddPCR method to determine the expression and potency of AAV vectors. Mol. Ther. - Methods Clin. Dev. 23, 68–77 (2021).
11. Wang, D., Tai, P. W. L. & Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat. Rev. Drug Discov. 18, 358–378 (2019).
12. Mingozzi, F. & High, K. A. Immune responses to AAV vectors: overcoming barriers to successful gene therapy. Blood 122, 23–36 (2013).
13. Murphy, S. L., Li, H., Zhou, S., Schlachterman, A. & High, K. Prolonged Susceptibility to Antibody-mediated Neutralization for Adeno-associated Vectors Targeted to the Liver. Mol. Ther. 16, 138–145 (2008).
14. Jiang, H. et al. Effects of transient immunosuppression on adenoassociated, virus-mediated, liver-directed gene transfer in rhesus macaques and implications for human gene therapy. Blood 108, 3321–3328 (2006).
15. Mingozzi, F. et al. Prevalence and pharmacological modulation of humoral immunity to AAV vectors in gene transfer to synovial tissue. Gene Ther. 20, 417–424 (2013).
16. Li, H. et al. Adeno-associated Virus Vectors Serotype 2 Induce Prolonged Proliferation of Capsid-Specific CD8+ T Cells in Mice. Mol. Ther. 19, 536–546 (2011).
17. Mingozzi, F. et al. CD8+ T-cell responses to adeno-associated virus capsid in humans. Nat. Med. 13, 419–422 (2007).
18. Wang, L., Figueredo, J., Calcedo, R., Lin, J. & Wilson, J. M. Cross-Presentation of Adeno-Associated Virus Serotype 2 Capsids Activates Cytotoxic T Cells But Does Not Render Hepatocytes Effective Cytolytic Targets. Hum. Gene Ther. 18, 185–194 (2007).
19. Manno, C. S. et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat. Med. 12, 342–347 (2006).
20. Ertl, H. C. J. Preclinical models to assess the immunogenicity of AAV vectors. Cell. Immunol. 342, 103722 (2019).
21. Verdera, H. C., Kuranda, K. & Mingozzi, F. AAV Vector Immunogenicity in Humans: A Long Journey to Successful Gene Transfer. Mol. Ther. 28, 723–746 (2020).
22. Martino, A. T. et al. Engineered AAV vector minimizes in vivo targeting of transduced hepatocytes by capsid-specific CD8+ T cells. Blood 121, 2224–2233 (2013).
23. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990).
24. Acta1 actin alpha 1, skeletal muscle [Mus musculus (house mouse)] - Gene - NCBI. https://www.ncbi.nlm.nih.gov/gene?Cmd=DetailsSearch&Term=11459.
25. Kozera, B. & Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 54, 391–406 (2013).
26. Xie, H. et al. Selection and Validation of Reference Genes for RT-qPCR Analysis in Spinacia oleracea under Abiotic Stress. BioMed Res. Int. 2021, 4853632 (2021).
27. Droplet Digital PCR Applications Guide.
28. Tiwari, G. & Tiwari, R. Bioanalytical method validation: An updated review. Pharm. Methods 1, 25–38 (2010).
29. Guidance for Industry: Gene Therapy Clinical Trials – Observing Subjects for Delayed Adverse Events. 25.
30. Long Term Follow-Up After Administration of Human Gene Therapy Products; Guidance for Industry. 37.
31. How much blood can I take from a mouse without endangering its health? The Jackson Laboratory https://www.jax.org/news-and-insights/2005/october/how-much-blood-can-i-take-from-a-mouse-without-endangering-its-health.

Acknowledgements: Conflict of Interest Statement. The authors are employed by and receive compensation from companies that are involved in development and validation of ddPCR and qPCR methods and are listed on the title page of the manuscript. The authors have no other relevant affiliations or financial involvements with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.
Disclaimer: The views and conclusion presented in this paper are the those of the authors and do not necessarily reflect the representative affiliation or company’s position on the subject.


Table 1: Adaption of FDA Bioanalytical Method Validation Guideline to Q-PCR PK Method


Figure 1. Calibration of Q-PCR and ddPCR of 4 Fold Serially Diluted pAAV-GFP DNA Spiked in Human Blood Genomic DNA


Figure 2. Linear Regression of Q-PCR and ddPCR of 4 Fold Serially Diluted pAAV-GFP DNA