(P 249) SARCOMA GENE FUSION BREAKPOINTS: NON-RANDOM EVENT PATTERNS IN SARCOMAS WITH GENE FUSIONS INCLUDING EWING SARCOMA, DSRCT, RHABDOMYOSARCOMA, SYNOVIAL SARCOMA, CCNB3-BCOR, AND CIC-DUX

Objective: Since 2019 pathology at Cleveland Clinic has used a Next Generation Sequencing (NGS) sarcoma panel to identify sarcoma-associated gene fusions. We sought to review 3.5 years of experience to identify the potential ability of our NGS panel for not only diagnostic conformation but also to provide a teaching set for in-frame analysis of coding sequence and resultant mRNA > amino acids that span sarcoma gene fusion breakpoints. The goal was to determine whether or not breakpoints were identical, similar, or different for sarcomas, especially Ewing family tumors and alveolar rhabdomyosarcoma. Such information could shed light on gene fusions as not only drivers of sarcoma, but also some potential immunologic options for future mRNA vaccines.

Methods: Pathology reports and gene fusions were analyzed using the Cleveland Clinic NGS panel from Jan 2019 to June 2022. This sarcoma NGS panel is based on anchored multiplex polymerase chain reaction (PCR) enriched for 34 gene targets. The amplicons were subjected to massively parallel sequencing with 151x2 cycle pair-end reads. An informatics pipeline was used for read alignment (GRCh37 as reference genome), fusion identification, and annotation. A program to display data as the DNA code spanning the fusion gene breakpoint and amino acid sequence of in-frame mRNA spanning the gene fusion breakpoint was written to allow “at-a-glance” pattern recognition of identical, similar, or unique gene fusions. The DNA sequence across the gene fusion breakpoint and translational amino acid sequences were compared in a preliminary teaching set of sarcoma patients seen in clinic and during virtual visits who had provided paraffin blocks for analysis (figure 1).

Results: As of June 2022, 102/152 (67%) EWS-FLI1 fusions included 5 more common hot spots:

24 chr22:29683122-chr11:128651853
31 chr22:29683123-chr11:128651853
39 chr22:29683123-chr11:128675261
8 chr22:29684775-chr11:128651853
10 chr22:29684775-chr11:128675261

EWS-FLI1 breakpoint fusion peptide analysis in the training set indicated EWS-FLI1 exon 7-7 and EWS-FLI1 7-6 were the most common (28/35 80%). For example the [30]<>[30] base pairs spanning the EWS-FLI1 Exon 7-7 breakpoint:

GCCAACAGAGCAGCAGCTACGGGCAGCAGA]<>[ACCCTTCTTATGACTCAGTCAGAAGAGGAG

coded for a [10]<>[10] 20 mer peptide:

SQQSSSYGQQ]<>[NPSYDSVRRG

as illustrated in figure 2. Some patients had EWS exon 7-FLI1 exon 9 and EWS exon 7-FEV exon 2 in the training set, too (table 1).

EWS exon 7 was also a common breakpoint in desmoplastic small round cell tumor (DSRCT). In the training set 5/7 DSRCT were EWS-WT1 exon 7-7 (table 1); However 2/7 DSRCT were EWS-WT1 exon 9-7; In EWS-ERG fusions only 2 hot spots were identified as more common than others (11/34; 33%):

5 chr22:29683123-chr21:39755845
6 chr22:29683123-chr21:39764366)

In the training set 2/4 EWS-ERG were EWS exon 7-ERG exon 9 (see table 1). Thus, a specific EWS Exon 7 breakpoint appears to be common and identical in EWS-FLI1, EWS-WT1, and EWS-ERG this training set.

In-frame analysis also yielded information for clear cell (EWS-ATF), synovial (SS18-SSX2), CCNB3-BCOR, and COC-DIX sarcomas and rhabdomyosarcoma (table 2). Interestingly, although the CIC-DUX exon 20-1 fusion in-frame analysis (N=3) showed some similar but not identical patterns, PAX3-FOXO1 exon 7-2 and PAX7-FOXO1 exon 7-2 (N=4) had identical breakpoints and in-frame 6 aa on the 3’side (table 2).

Conclusion: Very detailed breakpoint information can be obtained from our NGS panel. Ewing sarcoma and DSRCT often share an identical EWS exon 7 breakpoint as well as PAX3-FOXO1 and PAX7-FOXO1 indicating two common non-random sarcoma gene fusion event patterns. This information can be used for modeling of potential immunogenic peptides of different lengths and sequences that span sarcoma breakpoints. Such information can be considered a first step towards development of group and personalized vaccines against fusion-gene associated sarcomas.

Anderson Fig 1 CTOS fusion gene + legend.pptx

Anderson Fig 2 CTOS Analysis + legend.pptx

Table 1 EWS Exon 7 fusion genes+ in-frame analysis.docx

Table 2 Gene fusion Sarcomas.docx